j

Biomedical Science

Bioinformatics Databases and Tools

Bioinformatics Exercises

How do I Blast?

Let's find out what species the following sequence belongs to.

GAATTCCGGAAGCGAGCAAGAGATAAGTCCTGGCATCAGATACAGTTGGAGATAAGGACG

GACGTGTGGCAGCTCCCGCAGAGGATTCACTGGAAGTGCATTACCTATCCCATGGGAGCC

ATGGAGTTCGTGGCGCTGGGGGGGCCGGATGCGGGCTCCCCCACTCCGTTCCCTGATGAA

GCCGGAGCCTTCCTGGGGCTGGGGGGGGGCGAGAGGACGGAGGCGGGGGGGCTGCTGGCC

TCCTACCCCCCCTCAGGCCGCGTGTCCCTGGTGCCGTGGGCAGACACGGGTACTTTGGGG

ACCCCCCAGTGGGTGCCGCCCGCCACCCAAATGGAGCCCCCCCACTACCTGGAGCTGCTG

CAACCCCCCCGGGGCAGCCCCCCCCATCCCTCCTCCGGGCCCCTACTGCCACTCAGCAGC

GGGCCCCCACCCTGCGAGGCCCGTGAGTGCGTCATGGCCAGGAAGAACTGCGGAGCGACG

GCAACGCCGCTGTGGCGCCGGGACGGCACCGGGCATTACCTGTGCAACTGGGCCTCAGCC

TGCGGGCTCTACCACCGCCTCAACGGCCAGAACCGCCCGCTCATCCGCCCCAAAAAGCGC

CTGCTGGTGAGTAAGCGCGCAGGCACAGTGTGCAGCCACGAGCGTGAAAACTGCCAGACA

TCCACCACCACTCTGTGGCGTCGCAGCCCCATGGGGGACCCCGTCTGCAACAACATTCAC

GCCTGCGGCCTCTACTACAAACTGCACCAAGTGAACCGCCCCCTCACGATGCGCAAAGAC

GGAATCCAAACCCGAAACCGCAAAGTTTCCTCCAAGGGTAAAAAGCGGCGCCCCCCGGGG

GGGGGAAACCCCTCCGCCACCGCGGGAGGGGGCGCTCCTATGGGGGGAGGGGGGGACCCC

TCTATGCCCCCCCCGCCGCCCCCCCCGGCCGCCGCCCCCCCTCAAAGCGACGCTCTGTAC

GCTCTCGGCCCCGTGGTCCTTTCGGGCCATTTTCTGCCCTTTGGAAACTCCGGAGGGTTT

TTTGGGGGGGGGGCGGGGGGTTACACGGCCCCCCCGGGGCTGAGCCCGCAGATTTAAATA

ATAACTCTGACGTGGGCAAGTGGGCCTTGCTGAGAAGACAGTGTAACATAATAATTTGCA

CCTCGGCAATTGCAGAGGGTCGATCTCCACTTTGGACACAACAGGGCTACTCGGTAGGAC

CAGATAAGCACTTTGCTCCCTGGACTGAAAAAGAAAGGATTTATCTGTTTGCTTCTTGCT

GACAAATCCCTGTGAAAGGTAAAAGTCGGACACAGCAATCGATTATTTCTCGCCTGTGTG

AAATTACTGTGAATATTGTAAATATATATATATATATATATATATCTGTATAGAACAGCC

TCGGAGGCGGCATGGACCCAGCGTAGATCATGCTGGATTTGTACTGCCGGAATTC

 

We will use BLAST to check what species does the sequence belongs to. Here are the steps:

1. Copy the sequence.

2. Go to NCBI website

3. Select BLAST link under Popular Resources. The link takes you to the Blast Homepage.

4. On the BLAST home page select the link to the “nucleotide blast”.

 

On the standard  Nucleotide  BLAST page enter your query sequence.

 

There are several settings and options, but you do not have to change any. Simply click on the BLAST button.

 

After your BLAST run completes, you should see results like this:

 

If you mouse over the graphics of the top alignment, it says that the sequence is Gallus gallus GATA binding protein 1.

 

 

Similarly, the second alignment is Xenopus laevis GATA binding protein 2 (gata2):

 

 

Scroll down the search results page to see the alignment of your query sequence to the Gallus gallus sequence. Link to the subject sequence in GenBank (which is a part of the Nucleotide database). The link opens in a separate tab and you can verify that Gallus gallus is chicken.

Conclusion: The sequence is constructed from sequences of chicken and frog.

How Do I Find Genes in a Particular Location of Chromosome

Example:

Suppose you are trying to find out what genes are involved on chromosome 5 from nts 204,700-5,500,000. 

Step 1:  Go to NCBI GENE 

Type human[orgn] into search box & hit Search

This tells the database to search for the organism

Enter human[orgn] into the search box 

Step 2: Filter by chromosome location and nt range

2. Click Chromosome locations more from the Filters on the left side of the results page.

The Chromosome locations menu appears.

Select an organism by typing or scrolling to Homo sapiens.

You have been given the information that the deletion is chromosome 5, nt range from 204700 to 5500000, so enter this into the boxes at the bottom of the Window.

Click Apply.

 You should retrieve 93 results. 

Step 3 - Sort by Chromosome

3. You now have the list of all genes reported on chromosome 5, nt range from 204700 to 5500000. This is the data you were seeking.

Change the Display Settings to ‘Sort by Chromosome’

This sorts your search results in the order of the genes on the chromosome, from p-arm end to q-arm end.

Skip to main content

Claude Moore Health Sciences Library
1350 Jefferson Park Avenue P.O. Box 800722
Charlottesville, VA 22908 (Directions)

facebook twitter instagram
© 2018 by the Rector and Visitors of the University of Virginia
Copyright & Privacy